rabbit polyclonal anti-wave2 Search Results


92
NSJ Bioreagents beta-actin antibody
Beta Actin Antibody, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/beta-actin antibody/product/NSJ Bioreagents
Average 92 stars, based on 1 article reviews
beta-actin antibody - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
Millipore wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc
Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Wave2 3 † Aucagggugaggugggaaagauggg Uagucccacuccacccuuucuaccc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc/product/Millipore
Average 90 stars, based on 1 article reviews
wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti wave2 polyclonal antibody
Figure 3. Analysis of WAVE1, <t>WAVE2,</t> and WAVE3 protein levels. Western analysis was performed on 50 g of protein extracted from the cerebral cortex and hippocampus of wild- type(Wt)miceaswellasfrommiceheterozygous(Het)andhomozygous(KO)forthegene-trap insertion (n 3). The analysis was performed using an anti-WAVE1 polyclonal primary anti- body (A), an anti-WAVE2 polyclonal primary antibody (B), and an anti-WAVE3 polyclonal pri- maryantibody(C).Allblotswerenormalizedbyreprobingwithananti-actinprimaryantibody. Error bars indicate SEM.
Anti Wave2 Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti wave2 polyclonal antibody/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
anti wave2 polyclonal antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology rabbit polyclonal anti-wave2 antibody (cat#: 3659)
Effects of SKAP2 RNAi on ARP2 and <t>WAVE2</t> expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).
Rabbit Polyclonal Anti Wave2 Antibody (Cat#: 3659), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti-wave2 antibody (cat#: 3659)/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-wave2 antibody (cat#: 3659) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology goat anti wave2 polyclonal antibody
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Goat Anti Wave2 Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat anti wave2 polyclonal antibody/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
goat anti wave2 polyclonal antibody - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

95
Proteintech anti wave 2
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Anti Wave 2, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti wave 2/product/Proteintech
Average 95 stars, based on 1 article reviews
anti wave 2 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
Upstate Biotechnology Inc rabbit anti-human wave2 polyclonal ab
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Rabbit Anti Human Wave2 Polyclonal Ab, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti-human wave2 polyclonal ab/product/Upstate Biotechnology Inc
Average 90 stars, based on 1 article reviews
rabbit anti-human wave2 polyclonal ab - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Abbkine Inc anti-wave2

Anti Wave2, supplied by Abbkine Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-wave2/product/Abbkine Inc
Average 90 stars, based on 1 article reviews
anti-wave2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Merck KGaA anti-phospho-wave2 (ser343) antibody

Anti Phospho Wave2 (Ser343) Antibody, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-phospho-wave2 (ser343) antibody/product/Merck KGaA
Average 90 stars, based on 1 article reviews
anti-phospho-wave2 (ser343) antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc rabbit monoclonal anti wave2

Rabbit Monoclonal Anti Wave2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit monoclonal anti wave2/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
rabbit monoclonal anti wave2 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc wave2

Wave2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave2/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
wave2 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
ECM Biosciences anti py150 wave2

Anti Py150 Wave2, supplied by ECM Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti py150 wave2/product/ECM Biosciences
Average 93 stars, based on 1 article reviews
anti py150 wave2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study

Journal: Cancer Science

Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices

doi: 10.1111/j.1349-7006.2008.00927.x

Figure Lengend Snippet: Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study

Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon, rabbit pAb (AB4226) WAVE2‐3 † AUCAGGGUGAGGUGGGAAAGAUGGG UAGUCCCACUCCACCCUUUCUACCC Chemicon, rabbit pAb (AB4226) Control GACGUGAAACCGAAGAACGTT TTCUGCAGUUUGGCUUCUUGC Open in a separate window † Invitrogen stealth siRNA.

Techniques:

(a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.

Journal: Cancer Science

Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices

doi: 10.1111/j.1349-7006.2008.00927.x

Figure Lengend Snippet: (a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.

Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon, rabbit pAb (AB4226) WAVE2‐3 † AUCAGGGUGAGGUGGGAAAGAUGGG UAGUCCCACUCCACCCUUUCUACCC Chemicon, rabbit pAb (AB4226) Control GACGUGAAACCGAAGAACGTT TTCUGCAGUUUGGCUUCUUGC Open in a separate window † Invitrogen stealth siRNA.

Techniques: Transfection, Cell Culture, Extraction, Western Blot, Expressing

Figure 3. Analysis of WAVE1, WAVE2, and WAVE3 protein levels. Western analysis was performed on 50 g of protein extracted from the cerebral cortex and hippocampus of wild- type(Wt)miceaswellasfrommiceheterozygous(Het)andhomozygous(KO)forthegene-trap insertion (n 3). The analysis was performed using an anti-WAVE1 polyclonal primary anti- body (A), an anti-WAVE2 polyclonal primary antibody (B), and an anti-WAVE3 polyclonal pri- maryantibody(C).Allblotswerenormalizedbyreprobingwithananti-actinprimaryantibody. Error bars indicate SEM.

Journal: The Journal of Neuroscience

Article Title: Characterization of the WAVE1 Knock-Out Mouse: Implications for CNS Development

doi: 10.1523/jneurosci.23-08-03343.2003

Figure Lengend Snippet: Figure 3. Analysis of WAVE1, WAVE2, and WAVE3 protein levels. Western analysis was performed on 50 g of protein extracted from the cerebral cortex and hippocampus of wild- type(Wt)miceaswellasfrommiceheterozygous(Het)andhomozygous(KO)forthegene-trap insertion (n 3). The analysis was performed using an anti-WAVE1 polyclonal primary anti- body (A), an anti-WAVE2 polyclonal primary antibody (B), and an anti-WAVE3 polyclonal pri- maryantibody(C).Allblotswerenormalizedbyreprobingwithananti-actinprimaryantibody. Error bars indicate SEM.

Article Snippet: The membranes were incubated in a 1:1000 dilution of an anti-WAVE1 polyclonal antibody, a 1:200 dilution of an anti-WAVE2 polyclonal antibody (Santa Cruz Biotechnology), or a 1:200 dilution of an anti-WAVE3 polyclonal antibody (Santa Cruz Biotechnology) overnight at 4°C.

Techniques: Western Blot

Effects of SKAP2 RNAi on ARP2 and WAVE2 expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).

Journal: Cell Cycle

Article Title: SKAP2 regulates Arp2/3 complex for actin-mediated asymmetric cytokinesis by interacting with WAVE2 in mouse oocytes

doi: 10.1080/15384101.2017.1380126

Figure Lengend Snippet: Effects of SKAP2 RNAi on ARP2 and WAVE2 expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).

Article Snippet: Rabbit polyclonal anti-WAVE2 antibody (Cat#: 3659) was from Santa Cruz (Santa Cruz, CA, USA).

Techniques: Expressing, Injection, Fluorescence, Western Blot

FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.

Journal: Journal of Biological Chemistry

Article Title: Dysbindin-1C Is Required for the Survival of Hilar Mossy Cells and the Maturation of Adult Newborn Neurons in Dentate Gyrus

doi: 10.1074/jbc.m114.590927

Figure Lengend Snippet: FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.

Article Snippet: Other antibodies used in this study were as follows: goat anti-WAVE2 polyclonal antibody (WB, 1:1000, sc-10394, Santa Cruz Biotechnology, Dallas, TX); goat anti- - dystrobrevin polyclonal antibody (WB, 1:200, sc-13815, Santa Cruz Biotechnology); mouse anti- -actin monoclonal antibody (WB, 1:10,000, A5441, Sigma); goat anti-Sox2 polyclonal antibody (IF, 1:1000, sc-17320, Santa Cruz Biotechnology); mouse anti-nestin monoclonal antibody (IF, 1:100, MAB353, Millipore, Billerica, MA); mouse anti-GFAP monoclonal antibody (IF, 1:1000, IF03L, Millipore); mouse anti-GAD67 monoclonal antibody (IF, 1:100, MAB5406, Millipore); mouse anti-calretinin monoclonal antibody (IF, 1:1000, MAB1568, Millipore); rat anti-BrdU monoclonal antibody (IF, 1:100, ab6326, Abcam, Cambridge, UK); goat anti-DCX polyclonal antibody (IF, 1:150, sc-8066, Santa Cruz Biotechnology); mouse anti-NeuN monoclonal antibody (IF, 1:800, MAB377, Millipore); rabbit antiS100 polyclonal antibody (IF, 1:1000, ab868, Abcam); rabbit anti-phospho-CREB (Ser133) polyclonal antibody (IF, 1:200, 9198, Cell Signaling Technology, Danvers, MA), monoclonal mouse anti-Flag antibody (WB, 1:5000, Sigma); and secondary antibody Alexa Fluor 408, 488, or 594 IgG (1:2000, Molecular Probes, Eugene, OR).

Techniques: Expressing, SDS Page, Western Blot, Negative Control, Control, Membrane, Fractionation, Marker, Sedimentation, Mutagenesis

Journal: iScience

Article Title: WASH interacts with Ku to regulate DNA double-stranded break repair

doi: 10.1016/j.isci.2021.103676

Figure Lengend Snippet:

Article Snippet: Rabbit polyclonal anti-WAVE2 , Abbkine , Cat#ABP53432.

Techniques: Recombinant, In Situ, Plasmid Preparation, Expressing, Construct, Software